Mutant Lines
The majority of mutant lines listed below correspond to target genes having nectary-enriched expression; however, some correspond to genes involved in pathways potentially affecting nectary function (e.g., hormone biosynthesis and response).
| Mutant Name | Description | Gene Locus | Experiment Protocol |
|---|---|---|---|
| SALK_143117 (Line 88) | Genotype = wild-type (no mutants isolated) | AT5G26660 | Mutant Protocol |
| SALK_048405 (line 87) | T-DNA insert in 300-UTR5; Genotype = homozygous, Expression = WT, Phenotype = no obvious phenotype | AT5G26660 | Mutant Protocol |
| SALK_016998 (Line 86) | T-DNA insert in exon; Genotype = Homozygous, Expression = Knock out, Phenotype = increase in nectar sugar (preliminary) | AT5G26660 | Mutant Protocol |
| CS26404 (Line 84) | genotype = wild-type (no mutants isolated); Landsberg erecta background | AT4G38620 | Mutant Protocol |
| CS2338 (Line 2) | Genotype = wild-type (no mutants isolated) | AT2G06050 | Mutant Protocol |
| CS25131 (cwinv4) (Line 3) | T-DNA insert in exon, Genotype = homozygous, Expression = knockout, Phenotype = no nectar | AT2G36190 | Mutant Protocol |
| CS25167 (Line 4) | SALK_135290, T-DNA in exon; Genotype = Homozygous, Expression = Knockout, Phenotype = no apparent phenotype | AT5G54160 | Mutant Protocol |
| CS3843 (Line 6) | shp1-1/shp2-2 double mutant in Ler; Genotype = Homozygous, Expression = Knockout, Phenotype = in progress, Note: Also at At2g42830 | AT3G58780 | Mutant Protocol |
| CS3844 (Line 7) | shp1-1/shp2-1 double mutant, Genotype = Homozygous, Expression = Knockout, Phenotype = in progress | AT3G58780 | Mutant Protocol |
| CS3845 (Line 8) | Genotype = Homozygous, Expression = Knockout, Phenotype = in progress | AT2G42830 | Mutant Protocol |
| CS3846 (Line 9) | shp1-1/shp2-2 double mutant; Genotype = Homozygous, Phenotype = in progress | AT2G42830 | Mutant Protocol |
| CS850593 (Line 11) | T-DNA insert in exon (WiscDsLox293-296invH11), Genotype = homozygous, Expression = knockout, Phenotype = none apparent | At5g09570 | Mutant Protocol |
| CS859448 (Line 12) | SALK_023397, Genotype = wild-type (no mutants isolated) | AT1G23300 | Mutant Protocol |
| CS876336 (SAIL_731_G10; Line 13) | T-DNA in exon, Genotype = homozygous, Expression = Knockout, Phenotype = in progress | AT1G19640 | Mutant Protocol |
| SALK_011372 (Line 14) | Genotype = wild-type (no mutants isolated) | AT2G39060 | Mutant Protocol |
| SALK_029478 (Line 15) | T-DNA insert in exon; Genotype = Homozygous, Expression = Knock Down, Phenotype = no obvious phenotype | AT4G00950 | Mutant Protocol |
| SALK_029876 (Line 16) | T-DNA in 3' UTR; Genotype = Homozygous, Expression = wild-type, Phenotype = no apparent phenotype | AT2G47810 | Mutant Protocol |
| SALK_030969 (Line 17) | T-DNA in 1000-promoter;Genotype = Homozygous, Expression = knockout, Phenotype = smaller lateral nectaries, reduced presence of median nectaries, reduced nectar production | AT3G01530 | Mutant Protocol |
| SALK_041504 (Line 18) | T-DNA insert in intron; Genotype = Homozygous, Expression = Knockdown, Phenotype = none apparent | AT2G26580 | Mutant Protocol |
| SALK_042711 (Line 19) | T-DNA in intron, Genotype = Homozygous, Expression = no change, Phenotype = no apparent difference | AT3G27810 | Mutant Protocol |
| SALK_058574 (Line 20) | Genotype = wild-type (no mutants isolated) | At5g09570 | Mutant Protocol |
| SALK_062354 (Line 21) | T-DNA in intron, Genotype = in progress, Expression = in progress, Phenotype = in progress | AT5G45950 | Mutant Protocol |
| SALK_065776 (Line 23) | T-DNA in exon; Genotype = Homozygous, Expression = Knock out, Phenotype = slight decrease in nectar production (preliminary) | AT3G01530 | Mutant Protocol |
| SALK_081671 (Line 24) | T-DNA in promoter; Genotype = Homozygous, Expression = no change, Phenotype = none apparent | AT1G51340 | Mutant Protocol |
| SALK_082098 (pin6-1, Line 25) | pin6-1; Genotype = Homozygous, Expression = Knock up, Phenotype = 30% increase in nectar sugar, reduced auxin response in lateral nectaries | AT1G77110 | Mutant Protocol |
| SALK_091772 (Line 26) | T-DNA insert in exon; Genotype = Homozygous, Expression = Knockout, Phenotype = slight increase in nectar production (preliminary) | At3g06330 | Mutant Protocol |
| SALK_092409 (Line 27) | Genotype = wild-type (no mutants isolated) | AT1G77110 | Mutant Protocol |
| SALK_110979 (Line 28) | T-DNA insert in exon; Genotype = Homozygous, Expression = knockout, Phenotype = no apparent phenotype | AT2G30650 | Mutant Protocol |
| SALK_126868 (Line 29) | T-DNA in exon; Genotype = Homozygous, Expression = Knockout, Phenotype = no apparent change in nectar sugar | AT5G44630 | Mutant Protocol |
| SALK_130094 (Line 30) | Genotype = wild-type (no mutants isolated) | AT2G36190 | Mutant Protocol |
| SALK_130163 (Line 31, cwinv4-1) | T-DNA insert in exon; Genotype = Homozygous, Expression = Knock out, Phenotype = no nectar secretion | AT2G36190 | Mutant Protocol |
| SALK_135290 (Line 32) | T-DNA in exon; Genotype = Homozygous, Expression = knockout, Phenotype = significant decrease in nectar sugar | AT5G54160 | Mutant Protocol |
| SALK_142456C (Line 33) | T-DNA insert in exon; Genotype = homozygous, Expression = knockout, Phenotype = slight increase in nectar sugar (preliminary) | AT3G11430 | Mutant Protocol |
| SALK_146526 (Line 34) | Genotype = wild-type (no mutants isolated) | AT5G54160 | Mutant Protocol |
| SALK_147937 (Line 35) | Genotype = wild-type (no mutants isolated) | AT1G23300 | Mutant Protocol |
| SALK_053482C (Line 38) | T-DNA insert in intron; Genotype = Homozygous, Expression = knockout, Phenotype = significant decrease in nectar production | AT3G09600 | Mutant Protocol |
| SALK_044168 (Line 39) | T-DNA insert in exon; Genotype = Homozygous, Expression = knockout, Phenotype = none apparent | AT5G40360 | Mutant Protocol |
| SALK_016333C (Line 40) | T-DNA insert in intron; Genotype = in progress | AT3G09600 | Mutant Protocol |
| SALK_052716C (Line 42) | T-DNA insert in intron; Genotype = Homozygous, Expression = Knock down, Phenotype = slight increase in nectar sugar (preliminary) | AT2G14210 | Mutant Protocol |
| CS24611 (arf10-1; Line 43) | T-DNA insert in intron; Genotype = homozygous, Expression = knockdown, Phenotype = in progress | AT2G28350 | Mutant Protocol |
| SALK_033424C (Line 44) | Genotype = Homozygous, Expression = knockout, Phenotype = no obvious phenotype | AT1G17960 | Mutant Protocol |
| SALK_149664C (Line 45) | T-DNA insert in exon; Genotype = Homozygous, Expression = Knockout, Phenotype = no obvious phenotype | At2g22680 | Mutant Protocol |
| SALK_004539 (Line 47) | Genotype = wild-type (no mutants isolated) | AT1G70270 | Mutant Protocol |
| SALK_004540 (Line 48) | Genotype = wild-type (no mutants isolated) | AT1G70270 | Mutant Protocol |
| CS816759 (SAIL_360_G01; Line 49) | Genotype = wild-type (no mutants isolated) | AT5G42230 | Mutant Protocol |
| SALK_067441 (Line 50) | T-DNA insert 300-UTR5; Genotype = Homozygous, Expression = Knock out, Phenotype = no apparent phenotype | AT1G20070 | Mutant Protocol |
| SALK_084513C (Line 51) | T-DNA in exon, Genotype = Homozygous, Expression = knockout, Phenotype = slight decrease in nectar production | At2g44480 | Mutant Protocol |
| SALK_151766C (Line 52) | T-DNA insert in 3' exon; Genotype = Homozygous, Expression = Knockout, Phenotype = in progress | At4g27260 | Mutant Protocol |
| SALK_044189C (Line 53) | T-DNA insert 300-UTR5; Genotype = Homozygous, Expression = Knock out, Phenotype = reduced nectar sugar | At1g02400 | Mutant Protocol |
| SALK_059724 (Line 54) | T-DNA insert 300-UTR5; Genotype = Homozygous, Expression = Knockout, Phenotype = reduced nectar sugar | At1g02400 | Mutant Protocol |
| SALK_104688 (Line 55) | Genotype = wild-type (no mutants isolated) | AT4G38810 | Mutant Protocol |
| SALK_051356 (Line 56) | T-DNA insert in 5' exon; Genotype = Homozygous, Expression = Knockout, Phenotype = slight increase in nectar sugar (preliminary) | AT4G38810 | Mutant Protocol |
| SALK_006267C (Line 57) | T-DNA insert 300-UTR5; Genotype = Homozygous, Expression = knockdown, Phenotype = no obvious phenotype | AT3G25640 | Mutant Protocol |
| SALK_117786 (Line 58) | Genotype = wild-type (no mutants isolated) | AT3G25640 | Mutant Protocol |
| SALK_119048C (Line 60) | T-DNA insert in exon; Genotype = in progress | AT5G67440 | Mutant Protocol |
| SALK_057639C (Line 61) | T-DNA insert 1000-Promotor; Genotype = Homozygous, Expression = knockdown, Phenotype = none apparent | AT5G43580 | Mutant Protocol |
| SALK_049540C (Line 62) | Genotype = Homozygous, Expression = Knock out, Phenotype = in progress | AT3G50410 | Mutant Protocol |
| SALK_101182C (Line 63) | T-DNA in exon; Genotype = Homozygous, Expression = Knock out, Phenotype = in progress | At4g25300 | Mutant Protocol |
| SALK_117958C (Line 64) | T-DNA insert in intron; Genotype = Homozygous, Expression = Knock out, Phenotype = in progress | AT1G03770 | Mutant Protocol |
| SALK_062060 (Line 65) | T-DNA insertion in exon; Genotype = Homozygous, Expression = Knock out, Phenotype = slight increase in nectar production | AT2G35920 | Mutant Protocol |
| SALK_022107C (Line 66) | T-DNA insert in exon; Genotype = Homozygous, Expression = knockout, Phenotype = in progress | AT4G34680 | Mutant Protocol |
| SALK_052803 (Line 68) | T-DNA in 300-UTR3; Genotype = in progress | At1g69970 | Mutant Protocol |
| SALK_030416 (Line 69) | Genotype = wild-type (no mutants isolated) | At1g69970 | Mutant Protocol |
| SALK_095291C (Line 70) | T-DNA insert in 5' exon; Genotype = Homozygous, Expression = Knock out, Phenotype = in progress | AT3G55890 | Mutant Protocol |
| SALK_048952C (Line 71) | T-DNA insert in exon; Genotype = Homozygous, Expression = Knock out, Phenotype = in progress | At5g52830 | Mutant Protocol |
| SALK_127834C (Line 72) | T-DNA in promoter; Genotype = Homozygous, Expression = knock-up, Phenotype = reduced nectar production | AT5G60760 | Mutant Protocol |
| SALK_142151 (Line 73) | T-DNA in exon; Genotype = Homozygous, Expression = Knock out, Phenotype = reduced nectar production, plieotropic mutant, homozygous plants are stunted/slow growing | AT1G23300 | Mutant Protocol |
| pin6-2; SALK_046393 (Line 74) | pin6-2; Genotype = Homozygous, Expression = Knock out, Phenotype = strong decrease in nectar sugar, decreased auxin response in lateral nectaries | AT1G77110 | Mutant Protocol |
| CS848985 (Line 75) | T-DNA insert in exon; Genotype = homozygous, Expression = knockout, Phenotype = in progress (preliminary: slight increase in nectar production) | At3g62150 | Mutant Protocol |
| SALK_060067C (Line 76) | T-DNA in 300-UTR3; Genotype = Homozygous, Expression = ?, Phenotype = ? | AT3G52290 | Mutant Protocol |
| SALK_128297 (Line 77) | T-DNA insert 1000-promoter; Genotype = Homozygous, Expression = Knock out, Phenotype = ? | AT2G39380 | Mutant Protocol |
| CS859942 (Line 78) | Genotype = Heterozygous, Expression = ?, Phenotype = ? | At1g51640 | Mutant Protocol |
| SALK_033663C (Line 79) | T-DNA in 300-UTR5; Genotype = Homozygous, Expression = in progress | AT3G52290 | Mutant Protocol |
| SALK_131778 (Line 80) | Genotype = wild-type (no mutants isolated) | AT4G12530 | Mutant Protocol |
| SALK_065341C (Line 81) | T-DNA located 300-UTR3, Genotype = Homozygous, Expression = no change, Phenotype = no obvious phenotype | AT4G12530 | Mutant Protocol |
| dad1; SALK_138439C (Line 82) | dad1; T-DNA in exon, Expression = knockout, Phenotype = no nectar secretion in young (Stage 13-15) open flowers, older flowers secrete nectar (Stage 17-19); male sterile. | At2g44810 | Mutant Protocol |
| SALK_014100 (Line 89) | Genotype = wild-type (no mutants isolated) | At4g30140 | Mutant Protocol |
| SALK_005455 (Line 90) | Genotype = Homozygous, Expression = Knock down, Phenotype = no apparent phenotype | At4g30140 | Mutant Protocol |
| SALK_017466C (cwinv4-2, Line 91) | cwinv4-2, T-DNA insert in promoter; Genotype = Homozygous, Expression = Knock down, Phenotype = reduced nectar secretion | AT2G36190 | Mutant Protocol |
| SALK_094878 (Line 92) | Genotype = Homozygous, Expression = in progress | AT2G36190 | Mutant Protocol |
| SALK_023397 (Line 93) | Genotype = wild-type (no mutants isolated) | AT1G23300 | Mutant Protocol |
| SALK_046398 (Line 94) | Genotype = wild-type (no mutants isolated) | AT1G77110 | Mutant Protocol |
| SALK_021147 (Line 95) | Genotype = wild-type (no mutants isolated) | AT1G77110 | Mutant Protocol |
| pin6-3; SALK_095142C (Line 97) | Genotype = Homozygous, Expression = Knock Down, Phenotype = strongly reduced nectar secretion and response to exogenous auxin | AT1G77110 | Mutant Protocol |
| CS3864 (sos3-1, Line 10) | Fast neutron mutant; hypersensitive to sodium and lithium stresses; plants accumulate more sodium and retain less potassium than wild type under salt stress; incapable of growing under low-potassium conditions; increased calcium in the culture medium can partially suppress the sodium hypersensitivity of plants and completely suppress the defect in potassium nutrition; trichomes absent on leaves and stems, some trichomes in leaf margins. Proc Natl Acad Sci U S A. 2000 Mar 28;97(7):3735-40. | AT5G24270 | Mutant Protocol |
| SALK_025526 (Line 99) | T-DNA in exon; Genotype = Homozygous, Expression = in progress | AT4G31570 | Mutant Protocol |
| SALK_016661 (Line 100) | Genotype = wild-type (no mutants isolated) | AT2G13650 | Mutant Protocol |
| SALK_018985C (Line 101) | Genotype = WT, Expression = ?, Phenotype = ? | AT4G24400 | Mutant Protocol |
| SALK_142508C (Line 102) | Genotype = Homozygous, Expression = Knock down, Phenotype = ? | AT1G75170 | Mutant Protocol |
| SALK_135953C (Line 103) | T-DNA insert in exon; Genotype = Homozygous, Expression = ?, Phenotype = ? | AT1G29230 | Mutant Protocol |
| SALK_032805C (Line 104) | Insert in exon; Genotype = Homozygous, Expression = ?, Phenotype = ? | AT1G73220 | Mutant Protocol |
| CS859743 (SALK_060960; Line 105) | Insert in exon; Genotype = Homozygous, Expression = ?, Phenotype = ? | AT2G01980 | Mutant Protocol |
| CS872805 (Line 106) | Genotype = WT, Expression = ?, Phenotype = ? | AT1G15170 | Mutant Protocol |
| CS873035 (Line 107) | Genotype = WT, Expression = ?, Phenotype = ? | AT4G30560 | Mutant Protocol |
| CS858214 (Line 113) | Genotype = WT, Expression = ?, Phenotype = ? | AT4G23920 | Mutant Protocol |
| SALK_003968 (Lines 112 & 114) | T-DNA insert in exon; Genotype = homozygous, Expression = knockout, Phenotype = ? | AT5G46540 | Mutant Protocol |
| CS878413 (Line 111) | T-DNA insert in exon; Genotype = WT, Expression = ?, Phenotype = ? | AT3G54820 | Mutant Protocol |
| SALK_114805C (Line 110) | Genotype = Homozygous, Expression = ?, Phenotype = ? | AT1G75370 | Mutant Protocol |
| SALK_017057 (Line 109) | T-DNA insert in exon; Genotype = homozygous, Expression = knockout, Phenotype = slight increase in nectar production | AT5G60760 | Mutant Protocol |
| CS837568 (Line 108) | Genotype = WT, Expression = ?, Phenotype = ? | AT5G41790 | Mutant Protocol |
| SALK_088752 (Line 149) | T-DNA insert in first exon; Genotype= Homozygous, Expression = knockdown, Phenotype = possibly less nectar | AT5G11110 | Mutant Protocol |
| SALK_102764 (Line 125) | Genotype = ?, Expression = ?, Phenotype = ? | AT1G35190 | Mutant Protocol |
| SALK_054720C (Line 126) | Genotype = WT, Expression = ?, Phenotype = ? | AT1G35190 | Mutant Protocol |
| CS310130 (Line 41) | Genotype = wild-type (no mutants isolated) | AT1G74820 | Mutant Protocol |
| SALK_015348C (Line 141) | T-DNA insert in intron; Genotype = homozygous, Expression = ?, Phenotype = ? | AT2G14210 | Mutant Protocol |
| SALK_096047 (Line 142) | T-DNA insert in intron; Genotype = homozygous, Expression = ?, Phenotype = ? | AT2G14210 | Mutant Protocol |
| SALK_096056 (Line 143) | T-DNA insert in intron; Genotype = homozygous, Expression = ?, Phenotype = ? | AT2G14210 | Mutant Protocol |
| SALK_131337C (Line 127) | T-DNA insertion in promoter region, Genotype = Homozygous, Expression = knockdown, Phenotype = slight decrease in nectar production | At2g44480 | Mutant Protocol |
| CS25117 (Line 128) | T-DNA insertion in exon, Genotype = Homozygous, Expression = knockout, Phenotype = significant reduction in nectar production | At2g44480 | Mutant Protocol |
| SALK_092050 (Line 135) | T-DNA insert in 3' UTR; Genotype = ?, Expression = ?, Phenotype = ? | AT3G11430 | Mutant Protocol |
| SALK_018117C (Line 136) | T-DNA insert in exon; Genotype = ?, Expression = ?, Phenotype = ? | AT3G11430 | Mutant Protocol |
| SALK_091777 (Line 138) | T-DNA insert in 3' UTR; Genotype = ?, Expression = ?, Phenotype = ? | AT3G11430 | Mutant Protocol |
| CS25698 (Line 123) | Genotype = ?, Expression = ?, Phenotype = ? | At3g62150 | Mutant Protocol |
| CS870843 (Line 124) | Genotype = WT, Expression = ?, Phenotype = ? | At3g62150 | Mutant Protocol |
| SALK_014376 (Line 133) | T-DNA insert 300-UTR5; Genotype = ?, Expression = ?, Phenotype = ? | At4g27260 | Mutant Protocol |
| SALK_040204 (Line 129) | Genotype = Homozygous, Expression = ?, Phenotype = ? | AT5G07680 | Mutant Protocol |
| SALK_006724 (Line 130) | Genotype = WT, Expression = ?, Phenotype = ? | AT5G07680 | Mutant Protocol |
| SALK_006735 (Line 131) | Genotype = Homozygous, Expression = ?, Phenotype = ? | AT5G07680 | Mutant Protocol |
| SALK_151114C (Line 150) | T-DNA insert in exon, Genotype = Homozygous, Expression = Knock out, Phenotype = less nectar, spindly, smaller rosette leaves | AT5G11110 | Mutant Protocol |
| SALK_064922C (Line 151) | T-DNA insert in exon, Genotype = Homozygous, Expression = WT, Phenotype = nectar about equal to WT | AT5G11110 | Mutant Protocol |
| SALK_078684C (Line 139) | Genotype = ?, Expression = ?, Phenotype = ? | AT5G16150 | Mutant Protocol |
| SALK_045195 (Line 140) | Genotype = ?, Expression = ?, Phenotype = ? | AT5G16150 | Mutant Protocol |
| SALK_148643C (Line 146) | T-DNA insert in exon, Genotype = Homozygous, Expression = possible knock down, Phenotype = possibly less nectar | AT5G20280 | Mutant Protocol |
| SALK_119162C (Line 147) | T-DNA insert in intron, Genotype = Homozygous, Expression = knock down, Phenotype = possibly less nectar | AT5G20280 | Mutant Protocol |
| SALK_099817C (Line 148) | T-DNA insert in exon, Genotype = Homozygous, Expression = possible knock down, Phenotype = nectar about equal to WT | AT5G20280 | Mutant Protocol |
| SALK_131861 (Line 153) | T-DNA insert 300-5'UTR; Genotype = Homozygous, Expression = ?, Phenotype = ?At5g20830 | AT5G20830 | Mutant Protocol |
| SALK_044615C (Line 154) | T-DNA insert 300-UTR5; Genotype = Homozygous, Expression = ?, Phenotype = ? | AT5G20830 | Mutant Protocol |
| CS859794 (Line 144) | T-DNA insert in exon, Genotype = Homozygous, Expression = Knock out, Phenotype = nectar about equal to WT | AT5G26340 | Mutant Protocol |
| SALK_021204C (Line 145) | T-DNA insert in intron, Genotype = Homozygous, Expression = Knock out, Phenotype = possibly more nectar | AT5G26340 | Mutant Protocol |
| SALK_057927 (Line 115) | T-DNA insert in intron; Genotype = ?, Expression = ?, Phenotype = ? | AT5G46540 | Mutant Protocol |
| SALK_097118 (Line 116) | Genotype = ?, Expression = ?, Phenotype = ? | AT5G46540 | Mutant Protocol |
| SALK_141713 (Line 117) | Genotype = ?, Expression = ?, Phenotype = ? | AT5G46540 | Mutant Protocol |
| SALK_097112 (Line 118) | Genotype = ?, Expression = ?, Phenotype = ? | AT5G46540 | Mutant Protocol |
| SALK_010326 (Line 119) | Genotype = ?, Expression = ?, Phenotype = ? | AT5G46540 | Mutant Protocol |
| SALK_057902 (Line 120) | Genotype = ?, Expression = ?, Phenotype = ? | AT5G46540 | Mutant Protocol |
| SALK_097111 (Line 121) | Genotype = ?, Expression = ?, Phenotype = ? | AT5G46540 | Mutant Protocol |
| SALK_097127 (Line 122) | Genotype = ?, Expression = ?, Phenotype = ? | AT5G46540 | Mutant Protocol |
| SALK_029533C (Line 134) | T-DNA insert 300-UTR5; Genotype = ? , Expression = ?, Phenotype = ? | AT5G51810 | Mutant Protocol |
| SALK_117457 (line 165) | T-DNA in 1000-Promoter; Genotype = wild-type | AT2G39060 | Mutant Protocol |
| SALK_202913C (line 166) | T-DNA in Intron; Genotype = homozygous; Expression = knockout; Phenotype = no nectar secretion, altered starch accumulation | AT2G39060 | Mutant Protocol |
| SALK_001853C (line 167) | Intron | AT1G74020 | Mutant Protocol |
| SALK_082809 (line 168) | T-DNA in 300-UTR5, Genotype = homozygous, Expression = in progress, Phenotype = in progress | AT5G24150 | Mutant Protocol |
| SALK_024504 (line 169) | T-DNA in 300-UTR5, Genotype = homozygous, Expression = in progress, Phenotype = in progress | AT5G24150 | Mutant Protocol |
| SALK_203620 (line 170) | T-DNA in Intron, Genotype = homozygous, Expression = in progress, Phenotype = in progress | AT1G18720 | Mutant Protocol |
| SALK_006464 (line 172) | Exon | AT5G65110 | Mutant Protocol |
| SALK_006486 (line 173) | T-DNA in Exon, Genotype = homozygous, Expression = in progress, Phenotype = in progress | AT5G65110 | Mutant Protocol |
| SALK_044183 (line 174) | 1000-Promotor | AT5G65110 | Mutant Protocol |
| SALK_072405 (line175) | T-DNA in Intron, Genotype = homozygous, Expression = in progress, Phenotype = in progress | AT3G54820 | Mutant Protocol |
| CS874335 (line177) | Genotype = WT | AT3G54820 | Mutant Protocol |
| SALK_050295 (line178) | Intron | AT3G10340 | Mutant Protocol |
| SALK_050284 (line179) | Intron | AT3G10340 | Mutant Protocol |
| SALK_109601 (line180) | Exon | AT3G10340 | Mutant Protocol |
| SALK_057031 (line181) | 1000-Promotor | AT5G44620 | Mutant Protocol |
| CS873504 (line182) | AT1G77850 | Mutant Protocol | |
| CS6149 (line183) | AT5G42650 | Mutant Protocol | |
| SALK_035548 (line184) | T-DNA in Exon, Genotype = homozygous, Expression = in progress, Phenotype = in progress | AT2G39940 | Mutant Protocol |
| SALK_045436 (line185) | Exon | AT2G39940 | Mutant Protocol |
| SALK_095916 (line186) | Intron | AT2G39940 | Mutant Protocol |
| SALK_084149 (line187) | T-DNA in 300-UTR5, Genotype = homozygous, Expression = in progress, Phenotype = in progress | AT3G48000 | Mutant Protocol |
| SALK_078568 (line188) | Intron | AT3G48000 | Mutant Protocol |
| SALK_084150 (line 189) | 300-UTR5 | AT3G48000 | Mutant Protocol |
| SALK_204768 (line190) | Exon | AT4G35480 | Mutant Protocol |
| SALK_064303 (line191) | 300-UTR5 | AT4G35480 | Mutant Protocol |
| CS879687 (line 192) | 300-UTR5 | AT4G35480 | Mutant Protocol |
| SALK_050267 (line193) | Exon | AT1G23010 | Mutant Protocol |
| SALK_016297 (line194) | T-DNA in Intron, Genotype = homozygous, Expression = in progress, Phenotype = in progress | AT1G23010 | Mutant Protocol |
| SALK_000305 (line195) | T-DNA in Intron, Genotype = homozygous, Expression = in progress, Phenotype = in progress | AT1G79700 | Mutant Protocol |
| SALK_018113 (line196) | T-DNA in Intron, Genotype = homozygous, Expression = in progress, Phenotype = in progress | AT1G79700 | Mutant Protocol |
| SALK_046920 (line197) | Exon | AT1G79700 | Mutant Protocol |
| SALK_103990 (line198) | T-DNA in Intron, Genotype = homozygous, Expression = in progress, Phenotype = in progress | AT1G79700 | Mutant Protocol |
| SALK_044551 (line199) | Intron | AT2G03530 | Mutant Protocol |
| SALK_143013 (line200) | T-DNA in Exon, Genotype = homozygous, Expression = in progress, Phenotype = in progress | AT2G03530 | Mutant Protocol |
| SALK_150805 (line201) | T-DNA in Exon, Genotype = homozygous, Expression = in progress, Phenotype = in progress | AT2G03530 | Mutant Protocol |
| CS822043 (line202) | Genotype = homozygous, Expression = in progress, Phenotype = in progress | AT3G02280 | Mutant Protocol |
| SALK_123688 (line203) | Exon | AT3G02280 | Mutant Protocol |
| SALK_127352 (line 204) | T-DNA in Intron, Genotype = homozygous, Expression = in progress, Phenotype = in progress | AT3G25810 | Mutant Protocol |
| SALK_142794 (line 205) | T-DNA in Intron, Genotype = homozygous, Expression = in progress, Phenotype = in progress | AT3G25810 | Mutant Protocol |
| CS801049 (line206) | Exon | AT3G45780 | Mutant Protocol |
| CS801080 (line207) | AT3G45780 | Mutant Protocol | |
| CS801090 (line208) | AT3G45780 | Mutant Protocol | |
| CS801091 (line209) | AT3G45780 | Mutant Protocol | |
| SALK_121302 (line210) | Exon | AT3G51400 | Mutant Protocol |
| SAIL_1244_A07 (line211) | Intron | AT4G02075 | Mutant Protocol |
| SALK_056165 (line212) | T-DNA in Intron, Genotype = homozygous, Expression = in progress, Phenotype = in progress | AT4G13100 | Mutant Protocol |
| SALK_088622 (line213) | Promoter or intron, depending on alternatively spliced transcript. | AT4G13100 | Mutant Protocol |
| CS25522 (Ler) (line214) | AT4G31820 | Mutant Protocol | |
| SALK_108406 | Exon | AT4G31820 | Mutant Protocol |
| SALK_108408 (line216) | T-DNA in Exon, Genotype = homozygous, Expression = in progress, Phenotype = in progress | AT4G31820 | Mutant Protocol |
| CS847578 (line217) | AT5G26310 | Mutant Protocol | |
| CS65799 (SAIL_190_A04) (line218) | 300-UTR5 | AT5G38120 | Mutant Protocol |
| CS65800 (SALK_137753) (line219) | T-DNA in Intron, Genotype = homozygous, Expression = in progress, Phenotype = in progress | AT5G38120 | Mutant Protocol |
| SALK_137753 (line220) | Intron | AT5G38120 | Mutant Protocol |
| SALK_148185 (line221) | AT5G38120 | Mutant Protocol | |
| SALK_075903 (line222) | 300-UTR5 | AT5G46115 | Mutant Protocol |
| CS26648 (Ler) (line223) | AT5G48880 | Mutant Protocol | |
| SALK_132871 (line224) | T-DNA in 1000-Promoter or 300-UTR5, Genotype = homozygous, Expression = in progress, Phenotype = in progress | AT5G48880 | Mutant Protocol |
| CS877588 (line 231) | intron | AT2G26580 | Mutant Protocol |
| SALK_087247 (line 232) | 5' UTR | AT2G28350 | Mutant Protocol |
| SALK_143232 (line233) | 5'UTR | AT2G28350 | Mutant Protocol |
| CS879452 (line 234) | intron | AT2G28350 | Mutant Protocol |
| SALK_056661 (line 235) | 1000-promoter | AT1G70270 | Mutant Protocol |
| SALK_104679 (line 238) | exon | AT4G38810 | Mutant Protocol |
| SALK_145441 (line 239) | intron | AT4G38810 | Mutant Protocol |
| SALK_062005 (line 241) | 300-UTR5 | AT3G25640 | Mutant Protocol |
| SALK_026189 (line 142) | exon | AT3G25640 | Mutant Protocol |
| SALK_072281 (line 243) | exon | AT5G67440 | Mutant Protocol |
| SALK_117255 (line 244) | exon | AT5G67440 | Mutant Protocol |
| SALK_105578 (line 245) | exon | At4g25300 | Mutant Protocol |
| SALK_070085 (line 246) | promoter | At4g25300 | Mutant Protocol |
| SALK_201993 (line 247) | promoter | At1g69970 | Mutant Protocol |
| SALK_062037 (line 249) | promoter | AT2G13650 | Mutant Protocol |
| SALK_204259 (line 250) | Promoter | AT2G13650 | Mutant Protocol |
| SALK_043593 (line 251) | Intron | AT2G13650 | Mutant Protocol |
| SALK_017821 (line 152) | T-DNA insert in intron, Genotype = Homozygous, Expression = WT, Phenotype = possibly more nectar | AT5G11110 | Mutant Protocol |
| CS873134 (line 155) | 300- UTR5 | AT1G75170 | Mutant Protocol |
| CS873035 (line 256) | exon | AT4G30560 | Mutant Protocol |
| SALK_026086 (line 257) | intron | AT4G30560 | Mutant Protocol |
| SALK_006784 ( line 258) | intron | AT4G23920 | Mutant Protocol |
| CS859980 (line 259) | intron | AT4G23920 | Mutant Protocol |
| SALK_040500 (line 261) | exon | AT1G32640 | Mutant Protocol |
| SALK_083483 (line 262) | exon | AT1G32640 | Mutant Protocol |
| SALK_062597 (line 264) | 300-UTR | AT1G77850 | Mutant Protocol |
| CS844602 (line 266) | 300 UTR5 | AT5G24150 | Mutant Protocol |
| myb21-4 | myb21-4, EMS mutant described in Reeves et al., 2012, Volume 8 | Issue 2 | e1002506; phenotype = no nectar secretion | AT1G62360 | Mutant Protocol |
| AT1G18720-T1 (amiRNA target #1) | amiRNA target #1 (TCAAGGCGAATATAAACCCCA) inserted into pPMK1, under control of the SWEET9 promoter (strong nectary-specific promoter); does not secrete nectar | AT1G18720 | Mutant Protocol |
| At1g18720-T2 (amiRNA target #2) | amiRNA target #2 (TTAAATTGTCTAACAGCGCGG) cloned into pPMK1 under control of the nectary-specific SWEET9 promoter; homozygous mutant produces no nectar. | AT1G18720 | Mutant Protocol |